Review



ppia cypha crispr system  (OriGene)


Bioz Verified Symbol OriGene is a verified supplier
Bioz Manufacturer Symbol OriGene manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    OriGene ppia cypha crispr system
    A. Images showing the array of diverse chromosome aberrations observed following prolonged treatment of AA8 CHO cells with CsA (5μM, 24hrs). Noocodazole (1nM, 24hrs) was also included to trap mitotic chromosomes. In the lefthand image panel individual breaks and various fusion events are marked with the red arrows. An extreme example of the latter is shown in the inset panel. We also found that CsA (5μM, 12hrs) induced sister chromatid exchanges (SCEs) as indicated by the red arrows in the righthand image panel. B. A graphical quantitation of the breakage and fusion events observed following CsA treatment of these AA8 cells (error bars are mean + s.d. of 3x independent determinations * p<0.05, Student’s t-test ). Fusion-type events, perhaps indicative of aberrant DNA repair outcomes were commonly observed event under these conditions. C. <t>CRISPR/Cas9</t> knockout of <t>PPIA</t> /CYPA and reconstitution in U2OS cells. Scrm denotes scrambled gRNA. KO denotes PPIA /CYPA knockout. Each line was stably reconstituted with C-terminally MYC-FLAG tagged wild-type (WT) PPIA /CYPA or a PPIA /CYPA engineered to be p.R55A, which is a peptidyl-prolyl cis-trans isomerase (PPI) catalytically dead variant (R55A). This line was employed throughout to ascertain whether the PPI activity of CYPA was required for whatever endpoint was being investigated. The upper panel shows CYPA expression. Note the absence of endogenous CYPA in the KO, as expected. The middle panel confirmed expression of the WT and R55A by monitoring the MYC tag. The lower panel confirms protein loading throughout via α-tubulin expression. D. Western blot analysis showing effective silencing of LIG4 (siLIG4) in the U2OS isogenic panel of scrambled (Scrm), PPIA /CYPA knockout (KO) and CYPA-p.R55A PPI-dead (R55A). Lamin B was used to confirm loading across the panel. E. Clonogenic survival of the U2OS isogenic panel following silencing of LIG4. We found reduced survival following transient siLIG4 in the knockout (KO) and PPI-dead (R55A) cell lines relative to the scrambled (Scrm) control, in the absence of exogenously supplied DNA damage (error bars indicate the mean + s.d. of n=3 independent determinations * p<0.05, Student’s t-test) . F. Clonogenic survival following treatment with increasing doses of CsA shows that Ku80-defective CHO cells (xrs-6) are markedly sensitive compared to their parental control line (CHO-K1) (error bars indicate the mean + s.d. of n=3 independent determinations) .
    Ppia Cypha Crispr System, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ppia cypha crispr system/product/OriGene
    Average 90 stars, based on 2 article reviews
    ppia cypha crispr system - by Bioz Stars, 2026-03
    90/100 stars

    Images

    1) Product Images from "A novel role for the peptidyl-prolyl cis-trans isomerase Cyclophilin A in DNA-repair following replication fork stalling via the MRE11-RAD50-NBS1 complex"

    Article Title: A novel role for the peptidyl-prolyl cis-trans isomerase Cyclophilin A in DNA-repair following replication fork stalling via the MRE11-RAD50-NBS1 complex

    Journal: bioRxiv

    doi: 10.1101/2023.06.27.546694

    A. Images showing the array of diverse chromosome aberrations observed following prolonged treatment of AA8 CHO cells with CsA (5μM, 24hrs). Noocodazole (1nM, 24hrs) was also included to trap mitotic chromosomes. In the lefthand image panel individual breaks and various fusion events are marked with the red arrows. An extreme example of the latter is shown in the inset panel. We also found that CsA (5μM, 12hrs) induced sister chromatid exchanges (SCEs) as indicated by the red arrows in the righthand image panel. B. A graphical quantitation of the breakage and fusion events observed following CsA treatment of these AA8 cells (error bars are mean + s.d. of 3x independent determinations * p<0.05, Student’s t-test ). Fusion-type events, perhaps indicative of aberrant DNA repair outcomes were commonly observed event under these conditions. C. CRISPR/Cas9 knockout of PPIA /CYPA and reconstitution in U2OS cells. Scrm denotes scrambled gRNA. KO denotes PPIA /CYPA knockout. Each line was stably reconstituted with C-terminally MYC-FLAG tagged wild-type (WT) PPIA /CYPA or a PPIA /CYPA engineered to be p.R55A, which is a peptidyl-prolyl cis-trans isomerase (PPI) catalytically dead variant (R55A). This line was employed throughout to ascertain whether the PPI activity of CYPA was required for whatever endpoint was being investigated. The upper panel shows CYPA expression. Note the absence of endogenous CYPA in the KO, as expected. The middle panel confirmed expression of the WT and R55A by monitoring the MYC tag. The lower panel confirms protein loading throughout via α-tubulin expression. D. Western blot analysis showing effective silencing of LIG4 (siLIG4) in the U2OS isogenic panel of scrambled (Scrm), PPIA /CYPA knockout (KO) and CYPA-p.R55A PPI-dead (R55A). Lamin B was used to confirm loading across the panel. E. Clonogenic survival of the U2OS isogenic panel following silencing of LIG4. We found reduced survival following transient siLIG4 in the knockout (KO) and PPI-dead (R55A) cell lines relative to the scrambled (Scrm) control, in the absence of exogenously supplied DNA damage (error bars indicate the mean + s.d. of n=3 independent determinations * p<0.05, Student’s t-test) . F. Clonogenic survival following treatment with increasing doses of CsA shows that Ku80-defective CHO cells (xrs-6) are markedly sensitive compared to their parental control line (CHO-K1) (error bars indicate the mean + s.d. of n=3 independent determinations) .
    Figure Legend Snippet: A. Images showing the array of diverse chromosome aberrations observed following prolonged treatment of AA8 CHO cells with CsA (5μM, 24hrs). Noocodazole (1nM, 24hrs) was also included to trap mitotic chromosomes. In the lefthand image panel individual breaks and various fusion events are marked with the red arrows. An extreme example of the latter is shown in the inset panel. We also found that CsA (5μM, 12hrs) induced sister chromatid exchanges (SCEs) as indicated by the red arrows in the righthand image panel. B. A graphical quantitation of the breakage and fusion events observed following CsA treatment of these AA8 cells (error bars are mean + s.d. of 3x independent determinations * p<0.05, Student’s t-test ). Fusion-type events, perhaps indicative of aberrant DNA repair outcomes were commonly observed event under these conditions. C. CRISPR/Cas9 knockout of PPIA /CYPA and reconstitution in U2OS cells. Scrm denotes scrambled gRNA. KO denotes PPIA /CYPA knockout. Each line was stably reconstituted with C-terminally MYC-FLAG tagged wild-type (WT) PPIA /CYPA or a PPIA /CYPA engineered to be p.R55A, which is a peptidyl-prolyl cis-trans isomerase (PPI) catalytically dead variant (R55A). This line was employed throughout to ascertain whether the PPI activity of CYPA was required for whatever endpoint was being investigated. The upper panel shows CYPA expression. Note the absence of endogenous CYPA in the KO, as expected. The middle panel confirmed expression of the WT and R55A by monitoring the MYC tag. The lower panel confirms protein loading throughout via α-tubulin expression. D. Western blot analysis showing effective silencing of LIG4 (siLIG4) in the U2OS isogenic panel of scrambled (Scrm), PPIA /CYPA knockout (KO) and CYPA-p.R55A PPI-dead (R55A). Lamin B was used to confirm loading across the panel. E. Clonogenic survival of the U2OS isogenic panel following silencing of LIG4. We found reduced survival following transient siLIG4 in the knockout (KO) and PPI-dead (R55A) cell lines relative to the scrambled (Scrm) control, in the absence of exogenously supplied DNA damage (error bars indicate the mean + s.d. of n=3 independent determinations * p<0.05, Student’s t-test) . F. Clonogenic survival following treatment with increasing doses of CsA shows that Ku80-defective CHO cells (xrs-6) are markedly sensitive compared to their parental control line (CHO-K1) (error bars indicate the mean + s.d. of n=3 independent determinations) .

    Techniques Used: Quantitation Assay, CRISPR, Knock-Out, Stable Transfection, Variant Assay, Activity Assay, Expressing, Western Blot, Control



    Similar Products

    90
    OriGene ppia cypha crispr system
    A. Images showing the array of diverse chromosome aberrations observed following prolonged treatment of AA8 CHO cells with CsA (5μM, 24hrs). Noocodazole (1nM, 24hrs) was also included to trap mitotic chromosomes. In the lefthand image panel individual breaks and various fusion events are marked with the red arrows. An extreme example of the latter is shown in the inset panel. We also found that CsA (5μM, 12hrs) induced sister chromatid exchanges (SCEs) as indicated by the red arrows in the righthand image panel. B. A graphical quantitation of the breakage and fusion events observed following CsA treatment of these AA8 cells (error bars are mean + s.d. of 3x independent determinations * p<0.05, Student’s t-test ). Fusion-type events, perhaps indicative of aberrant DNA repair outcomes were commonly observed event under these conditions. C. <t>CRISPR/Cas9</t> knockout of <t>PPIA</t> /CYPA and reconstitution in U2OS cells. Scrm denotes scrambled gRNA. KO denotes PPIA /CYPA knockout. Each line was stably reconstituted with C-terminally MYC-FLAG tagged wild-type (WT) PPIA /CYPA or a PPIA /CYPA engineered to be p.R55A, which is a peptidyl-prolyl cis-trans isomerase (PPI) catalytically dead variant (R55A). This line was employed throughout to ascertain whether the PPI activity of CYPA was required for whatever endpoint was being investigated. The upper panel shows CYPA expression. Note the absence of endogenous CYPA in the KO, as expected. The middle panel confirmed expression of the WT and R55A by monitoring the MYC tag. The lower panel confirms protein loading throughout via α-tubulin expression. D. Western blot analysis showing effective silencing of LIG4 (siLIG4) in the U2OS isogenic panel of scrambled (Scrm), PPIA /CYPA knockout (KO) and CYPA-p.R55A PPI-dead (R55A). Lamin B was used to confirm loading across the panel. E. Clonogenic survival of the U2OS isogenic panel following silencing of LIG4. We found reduced survival following transient siLIG4 in the knockout (KO) and PPI-dead (R55A) cell lines relative to the scrambled (Scrm) control, in the absence of exogenously supplied DNA damage (error bars indicate the mean + s.d. of n=3 independent determinations * p<0.05, Student’s t-test) . F. Clonogenic survival following treatment with increasing doses of CsA shows that Ku80-defective CHO cells (xrs-6) are markedly sensitive compared to their parental control line (CHO-K1) (error bars indicate the mean + s.d. of n=3 independent determinations) .
    Ppia Cypha Crispr System, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ppia cypha crispr system/product/OriGene
    Average 90 stars, based on 1 article reviews
    ppia cypha crispr system - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    Image Search Results


    A. Images showing the array of diverse chromosome aberrations observed following prolonged treatment of AA8 CHO cells with CsA (5μM, 24hrs). Noocodazole (1nM, 24hrs) was also included to trap mitotic chromosomes. In the lefthand image panel individual breaks and various fusion events are marked with the red arrows. An extreme example of the latter is shown in the inset panel. We also found that CsA (5μM, 12hrs) induced sister chromatid exchanges (SCEs) as indicated by the red arrows in the righthand image panel. B. A graphical quantitation of the breakage and fusion events observed following CsA treatment of these AA8 cells (error bars are mean + s.d. of 3x independent determinations * p<0.05, Student’s t-test ). Fusion-type events, perhaps indicative of aberrant DNA repair outcomes were commonly observed event under these conditions. C. CRISPR/Cas9 knockout of PPIA /CYPA and reconstitution in U2OS cells. Scrm denotes scrambled gRNA. KO denotes PPIA /CYPA knockout. Each line was stably reconstituted with C-terminally MYC-FLAG tagged wild-type (WT) PPIA /CYPA or a PPIA /CYPA engineered to be p.R55A, which is a peptidyl-prolyl cis-trans isomerase (PPI) catalytically dead variant (R55A). This line was employed throughout to ascertain whether the PPI activity of CYPA was required for whatever endpoint was being investigated. The upper panel shows CYPA expression. Note the absence of endogenous CYPA in the KO, as expected. The middle panel confirmed expression of the WT and R55A by monitoring the MYC tag. The lower panel confirms protein loading throughout via α-tubulin expression. D. Western blot analysis showing effective silencing of LIG4 (siLIG4) in the U2OS isogenic panel of scrambled (Scrm), PPIA /CYPA knockout (KO) and CYPA-p.R55A PPI-dead (R55A). Lamin B was used to confirm loading across the panel. E. Clonogenic survival of the U2OS isogenic panel following silencing of LIG4. We found reduced survival following transient siLIG4 in the knockout (KO) and PPI-dead (R55A) cell lines relative to the scrambled (Scrm) control, in the absence of exogenously supplied DNA damage (error bars indicate the mean + s.d. of n=3 independent determinations * p<0.05, Student’s t-test) . F. Clonogenic survival following treatment with increasing doses of CsA shows that Ku80-defective CHO cells (xrs-6) are markedly sensitive compared to their parental control line (CHO-K1) (error bars indicate the mean + s.d. of n=3 independent determinations) .

    Journal: bioRxiv

    Article Title: A novel role for the peptidyl-prolyl cis-trans isomerase Cyclophilin A in DNA-repair following replication fork stalling via the MRE11-RAD50-NBS1 complex

    doi: 10.1101/2023.06.27.546694

    Figure Lengend Snippet: A. Images showing the array of diverse chromosome aberrations observed following prolonged treatment of AA8 CHO cells with CsA (5μM, 24hrs). Noocodazole (1nM, 24hrs) was also included to trap mitotic chromosomes. In the lefthand image panel individual breaks and various fusion events are marked with the red arrows. An extreme example of the latter is shown in the inset panel. We also found that CsA (5μM, 12hrs) induced sister chromatid exchanges (SCEs) as indicated by the red arrows in the righthand image panel. B. A graphical quantitation of the breakage and fusion events observed following CsA treatment of these AA8 cells (error bars are mean + s.d. of 3x independent determinations * p<0.05, Student’s t-test ). Fusion-type events, perhaps indicative of aberrant DNA repair outcomes were commonly observed event under these conditions. C. CRISPR/Cas9 knockout of PPIA /CYPA and reconstitution in U2OS cells. Scrm denotes scrambled gRNA. KO denotes PPIA /CYPA knockout. Each line was stably reconstituted with C-terminally MYC-FLAG tagged wild-type (WT) PPIA /CYPA or a PPIA /CYPA engineered to be p.R55A, which is a peptidyl-prolyl cis-trans isomerase (PPI) catalytically dead variant (R55A). This line was employed throughout to ascertain whether the PPI activity of CYPA was required for whatever endpoint was being investigated. The upper panel shows CYPA expression. Note the absence of endogenous CYPA in the KO, as expected. The middle panel confirmed expression of the WT and R55A by monitoring the MYC tag. The lower panel confirms protein loading throughout via α-tubulin expression. D. Western blot analysis showing effective silencing of LIG4 (siLIG4) in the U2OS isogenic panel of scrambled (Scrm), PPIA /CYPA knockout (KO) and CYPA-p.R55A PPI-dead (R55A). Lamin B was used to confirm loading across the panel. E. Clonogenic survival of the U2OS isogenic panel following silencing of LIG4. We found reduced survival following transient siLIG4 in the knockout (KO) and PPI-dead (R55A) cell lines relative to the scrambled (Scrm) control, in the absence of exogenously supplied DNA damage (error bars indicate the mean + s.d. of n=3 independent determinations * p<0.05, Student’s t-test) . F. Clonogenic survival following treatment with increasing doses of CsA shows that Ku80-defective CHO cells (xrs-6) are markedly sensitive compared to their parental control line (CHO-K1) (error bars indicate the mean + s.d. of n=3 independent determinations) .

    Article Snippet: The PPIA /CyPhA CRISPR system from Origene (Cat# KN203307) was used according to the manufacturer’s instructions and is composed of KN203307G1; PPIA gRNA vector 1 in pCas-Guide vector (Target Sequence: GGCAATGTCGAAGAACACGG).

    Techniques: Quantitation Assay, CRISPR, Knock-Out, Stable Transfection, Variant Assay, Activity Assay, Expressing, Western Blot, Control